cDNA Features  

General Information
Product ID FL28081
Description Homo sapiens SRY (sex determining region Y)-box 2, mRNA (cDNA clone MGC:2413 IMAGE:2823424), complete cds.
Accession # BC013923
 
Sequence Information
Transcript
>FL28081
cccgggccccccaaagtcccggccgggccgagggtcggcggccgccggcgggccgggccc
gcgcacagcgcccgcatgtacaacatgatggagacggagctgaagccgccgggcccgcag
caaacttcggggggcggcggcggcaactccaccgcggcggcggccggcggcaaccagaaa
aacagcccggaccgcgtcaagcggcccatgaatgccttcatggtgtggtcccgcgggcag
cggcgcaagatggcccaggagaaccccaagatgcacaactcggagatcagcaagcgcctg
ggcgccgagtggaaacttttgtcggagacggagaagcggccgttcatcgacgaggctaag
cggctgcgagcgctgcacatgaaggagcacccggattataaataccggccccggcggaaa
accaagacgctcatgaagaaggataagtacacgctgcccggcgggctgctggcccccggc
ggcaatagcatggcgagcggggtcggggtgggcgccggcctgggcgcgggcgtgaaccag
cgcatggacagttacgcgcacatgaacggctggagcaacggcagctacagcatgatgcag
gaccagctgggctacccgcagcacccgggcctcaatgcgcacggcgcagcgcagatgcag
cccatgcaccgctacgacgtgagcgccctgcagtacaactccatgaccagctcgcagacc
tacatgaacggctcgcccacctacagcatgtcctactcgcagcagggcacccctggcatg
gctcttggctccatgggttcggtggtcaagtccgaggccagctccagcccccctgtggtt
acctcttcctcccactccagggcgccctgccaggccggggacctccgggacatgatcagc
atgtatctccccggcgccgaggtgccggaacccgccgcccccagcagacttcacatgtcc
cagcactaccagagcggcccggtgcccggcacggccattaacggcacactgcccctctca
cacatgtgagggccggacagcgaactggaggggggagaaattttcaaagaaaaacgaggg
aaatgggaggggtgcaaaagaggagagtaagaaacagcatggagaaaacccggtacgctc
aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
 

QQ

咨询

扫一扫